IRB Barcelona logo

News

Highlighting IRB Barcelona's impact on society

In the media

Media mentions
El País - The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
Media mentions
La Vanguàrdia - Spaniard Salvador Aznar, from IRB Barcelona, in the top 50 biomedical researchers in the world
Media mentions
Catalan News - Ràdio Pati: Live concerts at home during cancer treatment
Media mentions
PocketVec: una revolución en la detección de puntos de interés farmacológico en el proteoma humano
Media mentions
Medical Xpress - Study identifies five key factors that predict response of cancer patients to immunotherapy
Media mentions
EurekAlert - Detective algorithm predicts best drugs for genetic disorders and cancer
Media mentions
Un proyecto pionero reúne en Barcelona a oncólogos y científicos en un mismo laboratorio para acelerar la lucha contra el cáncer - El Periodico
Media mentions
Éxito Rotundo en el 18º Torneo de Golf y Cena Solidaria XAP Constant - Sport
Media mentions
Qué fue de los alumnos 10 de Selectividad de hace una década - El País