Research Programme (field_news_research_programme) All programmesAging and MetabolismCancer ScienceCore FacilitiesMechanisms of Disease Research Group (field_news_research_group) Media mentions16 Jul 2025 Medical Xpress - An aggressive childhood cancer case opens new avenues for advanced cell therapies Media mentions11 Mar 2025 Investigadors catalans han descobert perquè una mateixa mutació provoca leucèmies (01:50:55 - 01:51:25) - Aquí Catalunya Media mentions11 Mar 2025 El estado de las células antes de mutar influye en la progresión de la leucemia y en la respuesta a las terapias - El Periódico Media mentions11 Mar 2025 Descobreixen per què una mateixa mutació pot causar leucèmies tan diferents - ARA Media mentions25 Feb 2025 MSN - How the same mutations give rise to very different types of leukemia Media mentions1 Jan 2025 La Vanguardia - Spanish scientist Joan Guinovart, founder of IRB Barcelona, dies Media mentions4 Dec 2024 El País - The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA Media mentions22 Oct 2024 La Vanguàrdia - Spaniard Salvador Aznar, from IRB Barcelona, in the top 50 biomedical researchers in the world Media mentions19 Oct 2024 Catalan News - Ràdio Pati: Live concerts at home during cancer treatment Pagination First page First Previous page < Page 1 Current page 2 Page 3 Page 4 Page 5 Page 6 Page 7 Page 8 Page 9 … Next page > Last page Last